?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAA23YA08FM1
Length(NT) : 417
Member of Contig: Contig160


Sequence:

>SY0AAA23YA08FM1
GATGCTCTCAAGACTTCCCGCCAGATTTTCCACCGAATGTATGCCTACGT
TGTCTACCGCATTGCCTTGTCACTCCACTTGGAGATATTTTTGGGTCTCT
GGATTGCCATTTTGAACGAGTCCCTCAACTTGAACCTTGTTGTCTTTATC
GCCATCTTTGCCGATATTGCTACCTTGGCCATCGCCTACGACAATGCGCC
CTTCTCCAAGTCTCCTGTCAAGTGGAACCTGCCCAAGCTCTGGGGCATGT
CTATCCTTCTCGGTCTTGTCCTTGCTATTGGTACCTGGATTGCACTTACC
ACTATGTTCGCCGGCGGAAGTGATGATCGCGGTATCGTTCAGAACTTTGG
TAATCGTGATGAGGTCTTGTTCTTGGAGATTTCCCTCACTGAGAACTGGC
TTATCTTCATTACTCGC

NCBI BlastX