?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAA22YL06FM1
Length(NT) : 713
Member of Contig: Contig112


Sequence:

>SY0AAA22YL06FM1
TTGGACGACAACAACAAACAACGGAAACCCTCTCTATACAATATATATAT
ATATATAGACTACCCCTCGAAGTTTGGAACATTCACAATCCCAAAACATC
CTTTAACACAAAAATCCTTTACTACTTTCTTACCTAGAAAGCTACCGACT
ACTGATCATCCCTTCAGCCATTCTATCAAACCGTCAAACTGAAGTACCCA
AACATTAAGAACTCCTCGAGCAATTCACTTGTTCAACCCACCGAGCCAGC
CGAAATGTCCCACTACGCGGTCCATACCGTTAACCCCTACCGGGGATCCA
CAGGCACTCTTGCCATGCCCCATTCCGCTCCTCGCAGCGGTCAGATGGTT
CCCATAAACCCCCCCTCCCCGGCCGAGTCTACCTGCTCATCCTGCGATTC
TTCGCTCCCACTCAATACCCCCTGGTCTGGGACCCCGACTTCTTCAACCA
CTTCTGTTTCTACTCACCACCATCCTCACCACCCTAGCCGCCCACGAAGA
CAGTCCATCAGTGATGGTGTTAGGATTGTTGAGGCTCCCCGCATGTCAGC
GGATGGCCGCCCTCCTCCTATCGTTGTTCACAGACGGCCCCCTGTGCCAT
CTCCCCCGCCAACCTCTCGATCACTGAATGCTTACCACACCGAATCCAGA
GCCCACGGTACCTACCGTGGCGATCGCGCTCTGCTTGTACCTGCATCATC
TGGTCGTGATCGT

NCBI BlastX