?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAA18YJ08FM1
Length(NT) : 216
Member of Contig: Contig3953


Sequence:

>SY0AAA18YJ08FM1
TTGGTCCTTCTTTCCTTCCCACTTTAATCCTATTTTTTCCTTTTTCTATT
TTTCGCGTTTTCAACATACCACGGGTATGGTGATTCTCTTGAGTTATTTC
ATGCAATCCACGGTGCTTGGCATTAATTTCTATTTCAGTGTTGGTTAGAT
TAAGTTTGTTTTGCGATCCGGTCTATATACCGGTAATACTTATATTTCTT
GTTTCACTTCCACCCC

NCBI BlastX