?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAA15YM22FM1
Length(NT) : 366
Member of Contig: Contig157


Sequence:

>SY0AAA15YM22FM1
TTGGCGAATACCGCAACGCAAACACACGTTCCCAGGTTGCCATCAACCGC
AGCAATCTTTACTTGTTGCGGCTTTCATTCATCTTCCATAATGGCATCTC
CCCTTTCTACTGTGGAGTGGCCGGCTAGCTTGGTCCGAAAAACCTTCATT
GATTACTTCAAAAATAATGGCCATACATTCGTGCCATCGTCTTCGGTAGT
GCCCCTCTCAGATCCGACCCTGCTATTTGCGAATGCTGGCATGAACCAAT
ATAAGTCAATTTTTCTCGGGACTGTGGATCCCTCATCAGACTTCGCCAGT
TTAAAACGGGCTGCGAACTCACAGAAGTGCATACGAGCTGGGGGTAAGCA
CAATGACCTTGACGAC

NCBI BlastX