?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAA14YD16FM1
Length(NT) : 660
Member of Contig: Contig111


Sequence:

>SY0AAA14YD16FM1
TTGGAACCGCAGCAGGTCTCCAAGGTGAAAAGCCTCTAGTTGATGGCTGC
AATGGTACCATTACTCCGTCAGATATCCAACTTCCTGACACTCCCGAGAT
ATGGAGAGAGAGCCCTCCCATGACTCCAGCATATATTTATCCTCCTAGTC
TGCTCCCAACCCACTCGAGCCCTTCGGTTCTCTTGCCGACTTGCCCCTCA
TTGTCACCAGCTTCGGATCACTCATCATCTCCGGAGCTCGATTTCTGTGA
TCCACGAAAGCTCACATATCCGTCACCCAATCCGTCCGCTTCTGACAAGG
ATTTGGAGTTTGCTACTCTTCCTTCCATTCGCGATGATGATGACGAACAC
AACTTCATGCTCGGTATGGGAAAGGACGATATTAAGACCGAGGGAAGGGA
TTTTGCCCACGGCTTCCTTGGTCTCGAGGAGCAACTCTCTGACTTCGAGT
CTGATAACGAGCTTGTCTCCGGATTGATGAACATGCCACAGAACACCATC
AACCCCGTCGATCTTCTCGGAAACAGGCGTCAGCGTGATGGCTTTGATGA
CGAGGAGGGCTGGGAGATGGATGACCTGAGCGATGATGAGAGCGTATCTG
GTGATATTAACAGCCAGGAATTTCAAGCACCGTTGTCTCCTCCTCCATCT
GATTCGTCTC

NCBI BlastX