?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAA10YN15FM1
Length(NT) : 401
Member of Contig: Contig160


Sequence:

>SY0AAA10YN15FM1
TTGGGGCATGTCTATCCTTCTCGGTCTTGTCCTTGCTATTGGTACCTGGA
TTGCACTTACCACTATGTTCGCCGGCGGAAGTGATGATCGCGGTATCGTT
CAGAACTTTGGTAATCGTGATGAGGTCTTGTTCTTGGAGATTTCCCTCAC
TGAGAACTGGCTTATCTTCATTACTCGCGCCAACGGTCCTTTTTGGTCCT
CTATTCCTTCTTGGCAATTGTCTGGTGCCATCTTGCTCGTTGATATCATT
GCTACTCTCTTCACCATCTTCGGTTGGTTTGAGAACAGCGAACAGACCAG
CATCGTCGCCGTCGTCCGTATTTGGATCTATTCTTTTGGTATTTTCTGTG
TCTTGGGCGGTGTTTACTATCTCCTCCAAGACTCTTTGCATTTGATAACT
T

NCBI BlastX