?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAA10YA21FM1
Length(NT) : 664
Member of Contig: Contig1196


Sequence:

>SY0AAA10YA21FM1
TTGGGCCCTCGTTTTCCTGTGGTACCTTCTTACGGCACGCCCCGGCGCTT
TCGCTCCAAAGTTTGTGGCCAGCATTGGTCTTATCCGTTCGTTACTTTGT
GGAGGCTGGGTATACATTACCTCCACCGATGACCATGACTATCACGATAT
CTTTATGATTTCTTACCTCGTCTTCACCCTCCCTTGGACGCTCGGTTGTC
TCGCCCTGTCCCCCATGAACCTTACAGCAATCAAGTATAGAAAGTTATTT
GCTGGTCTTTTCTTTGGTACCCTTGTACCACTGATTTATTTCTTTATCCA
GCACAAGGTCCACAAGGTCGCTGGAGCTTACACTATTTACGCTTTCTTTG
AATGGTCTCTCATCTTATTCGATGTTGGTTTTGATGCTGTTACTGCCCTA
GATTTTGAAGGATTCGAATTTAGAGTTGTAGATGTCAAGAGTGTCAGCAA
AGGAAAAAATATAGCGCTTTCCGACGCAGTTCTCGAAAGATCAAAGATGG
ATAAAAAGGATATCCCACAACAGTTTTTAACTGACACTTACTCATGGAAC
GATGTGCTCGATGCTCTTGCCGATGTTTACAGCGGGTTCATGTTTTGGTC
CATCCTGACATCACTCGGAGTGACTATTTGGTGTAAGTCACGAGCAAATC
GAAACAGCTTTGAG

NCBI BlastX