Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD9YP16FM1
Length(NT) : 696
Best Gene Model Blast : Link to GSTUMT00007972001 E-value : 1e-152
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein AN8415.2
Accession: ref|XP_681684.1| Score: 461 E_value: 5e-47
KEGG Definition: hypothetical protein
Accession: ani:AN8415.2 Score: 461 E_value: 2e-47
KOG Definition:
Classification: [Amino acid transport and metabolism, Lipid transport and metabolism].
Kog Number: KOG0141 Score: 220 E_value: 5e-19
PFAM Definition: Acyl-CoA_dh_M, Acyl-CoA dehydrogenase, middle domain. Central domain of Acyl-CoA dehydrogenase has a beta-barrel fold..
Pfam Number: pfam02770 Score: 129 E_value: 2e-08
Swissprot: P51174|ACADL_MOUSE
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion

Sequence:
>SY0AAD9YP16FM1
TTGGCTAAAAGTGGAGGAGTTTGATTATCTGCACTTTTTAATTTACAGTG
ATGAGGTTTGATTCAGCTTGTTTGCCCTACCGATATGTCGGTTGCCGCTG
TGGGGTAGGGTTTGACATGAAGTGTGGCTAGATGACGGGGAACGGGCTGT
CTGGTCCTGGTGCCTCGCTTACGACCGGGATAACATTCGGGGTTCCGCCG
ATATTAAAGTTTGGGAGCAAGCAATTGCTGGAGAGATTTATCCCGGATTT
GCTCATGGGGCGGGCGCGAAGCTGCATTGTGATTACGGAACCGGGGACCG
GGAGTGACGTAGCCGGGATTGAGAGAACGGCTGTGAAGTCAGCGGATGAG
AAGGAGTACATCGTTAATGGATCAAAGAAATGGTACTCCTCTTACCTTTG
CTTCATGGACCCAGGCTGACGTCTCAGGATCACGAACGGGATCTGGGCAG
ACTTCGTTACAACAGCCGTGCTCACCGGCGGCCCATGGCCTTCAGGTCTC
TCATTACTCCTCATCCCACTGAAGAACAACCTGTCCATCATCATCCGCAA
GTTGGTTATCATGGGCCTTGCTGCCTCCGGCACCACATACATAGAGTTCG
ATGACACCCATGTCCCAGTCGAAAATCTCATTGGCATAGAGGGCATGGGT
ATCCGCTGCATAATGACAAACTTCAACCACGAACTCTTAACCACCG

Sequences in the Contig:

SY0AAD9YP16FM1