Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD9YP07FM1
Length(NT) : 698
Best Gene Model Blast : Link to GSTUMT00009434001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_03117
Accession: ref|XP_001793700.1| Score: 516 E_value: 9e-51
KEGG Definition: hypothetical protein
Accession: ang:An02g14400 Score: 507 E_value: 5e-50
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG0412 Score: 257 E_value: 3e-23
PFAM Definition: No Hit Found
Swissprot: Q06096|COG4_YEAST
Gene Ontology:
GO:0017119 = Cellular component: Golgi transport complex
GO:0005515 = Molecular function: protein binding
GO:0000301 = Biological process: retrograde transport, vesicle recycling within Golgi

Sequence:
>SY0AAD9YP07FM1
TTGGCAACAACCTTCCACCAACATCCCACAATGACCACAGCAACAAATGG
CCGCAACCACAAACCTCGCGATCGAAATCCCTACGACTCCGACGACGATT
CGAGCAATGAAGATGATTTCTCACCTCCTCCCCCGGACGTTAACTCCTGC
ACAACTGTTGAAGAACTTCGTGCGGCTCTCGCTCATCTAACTGCCCAAGA
CGCTTGGCATAGACAACAAGCTCCGCACGTTGCTCTTGAAGCAATCTGAG
CTGGAGCACTCTCTCACCCGCCTAGACCTGCTACGAGCACATCTAGGCAC
GCAAGTCGTGGCGGCCCGCACACTATCAAACACAATGCTCTCCCCCGCGG
CAACCACCGCGCAGCGAGTCTCCTCCTCTGTGAAGCGTTTGGATATCGAG
CAATCCCGCGTTAGGGCGACGCTGGAGGTCGTTGAACAAGTTTCTGAGCT
GAAAGCTTGTGTTCTGGGGGTCACTGGGTCGATGGGTGCGCCACAGGATT
GGGAAACCGCAGCGAGCTTCCTACATCGTGCCGGGAAGATACCACAGGAG
ATCATCCGTGGAGAGTTCGCGGAGGAGATAGTGCCCACTGCTGAAGTTCC
GGATGTCCCTTCTGTAACATTGGAGAACGCGGCGGAGTCCCTATGTGGGC
TATTTCTCCGGGAGTTTGAGCGTGCGGCCGAAGCTGCTGATGGGGAGA

Sequences in the Contig:

SY0AAD9YP07FM1