Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD9YM07FM1
Length(NT) : 586
Best Gene Model Blast : Link to GSTUMT00004905001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001542750.1| Score: 302 E_value: 4e-26
KEGG Definition: KEKE-like motif-containing transcription regulator (Rlr1)/suppressor of sin4
Accession: aor:AO090701000253 Score: 302 E_value: 2e-26
KOG Definition:
Classification: [Transcription].
Kog Number: KOG1874 Score: 221 E_value: 3e-19
PFAM Definition: No Hit Found
Swissprot: Q8NI27|THOC2_HUMAN

Sequence:
>SY0AAD9YM07FM1
TTGGTGAGGATGTTAATATGGGAGGAACTCAGGACGGAGATACCGCTATC
GCCGTGGAAAAAACACTGTGGAACCCCGTATTGAAAAACATTATGGATGA
ACTCCGACCGGTCTTACCCACCTCTGAGTGGCCTGGCTCCTTGGCCTTCT
ATGTTACATTCTGGCACCTGTCACTCTATGATGTCTATGTCCCTATGGCT
ACTTATAAGAATGCTAGCGCTAGTATTCAGGACGAAATTGCGGCCCTACC
GGACAAGAGATCGCCACGCAGCTACGAGCTTTTGGGGTCCACTACCAAGT
TGAGTGAGGAAGTTAAAACGCACATATGCCATAATGGTTTAGTCAAGAAA
CGGCTTCAGCTCGAAAAGGATCACTGGTTTAACGACTTCTCTGATCCGCG
GGAGGTTACCAACGCTATAGTTCAGTATTGCCTAATGCCCCGGATTGTTT
TAAGCCCCAACGACGCCATATTTTGCTCGAAGCTTATCAAAGAGTTACAC
AAACTGGTGCCCCCGAAATTTCACACCGTTGGAATCTTTGATGCCATATT
CGGTAAACATATGGGGAAGACCATATTTACCTGCAC

Sequences in the Contig:

SY0AAD9YM07FM1