Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD9YM03FM1
Length(NT) : 622
Best Gene Model Blast : Link to GSTUMT00008543001 E-value : 1e-119
Numbers of ESTs : 1

Blast Results:

Nr Definition: beta tubulin
Accession: ref|XP_001594844.1| Score: 366 E_value: 7e-48
KEGG Definition: hypothetical protein; K07375 tubulin beta
Accession: ang:An08g03190 Score: 366 E_value: 4e-48
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG1375 Score: 242 E_value: 1e-21
PFAM Definition: Tubulin, Tubulin/FtsZ family, GTPase domain. This family includes the tubulin alpha, beta and gamma chains, as well as the bacterial FtsZ family of proteins. Members of this family are involved in polymer formation. FtsZ is the polymer-forming protein of bacterial cell division. It is part of a ring in the middle of the dividing cell that is required for constriction of cell membrane and cell envelope to yield two daughter cells. FtsZ and tubulin are GTPases. FtsZ can polymerise into tubes, sheets, and rings in vitro and is ubiquitous in eubacteria and archaea. Tubulin is the major component of microtubules..
Pfam Number: pfam00091 Score: 210 E_value: 6e-18
Swissprot: O42786|TBB_MYCPJ

Sequence:
>SY0AAD9YM03FM1
TTGGCTCTGCCCCCCTCCGTCTTACCATCTCCCTCTTAAGTCCTATTATC
AAGCTTCTCTACAGCTTGCCTTTTTTTGCGCTCTTAAGCTTTCTTCATCT
TTAACCAGAATGCGTGAAATTGTATTTATCCTTCTGTCTGATTCCCTGAC
GAAAATGCTTGGATATTGCTATATCCCAGGCGTTCCTCTGTCACCTCCAA
CCCTAGAGTTCTTTGCTGATGGTTCCATTTTTCCGTTATAGATTCATCTC
CAAACCGGACAATGCGGTAACCAAATTGGAACTGCTTTCTGGCAAACCAT
CGGTGGAGAGCATGGTCTTGACGGGTCTGGAGTGTATTTATCCCCCTTTT
ACCTGGCCTGATTGGCCTGGTTTTATTTGGTTCCGAGCTCTAATGTGGTG
GCCATAGCTATGGAGGAACCTCTGATATTCAATTGGAGCGTATGAGTGTA
TACTTCAACGAGGCTTCTGGAAGCAAGTATGTGCCACGTGCGGTGCTCGT
TGATCTTGAGCCTGGTACCATGGATGCGGTTCGCTCGGGTCCTTTTGGCC
AACTCTTCCGCCCTGACAACTTCGTCTTTGGTCAATCTGGTGCTGGTAAC
AATTGGGCCAAGGGTCATTATA

Sequences in the Contig:

SY0AAD9YM03FM1