Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD9YK02FM1
Length(NT) : 684
Best Gene Model Blast : Link to GSTUMT00011642001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CC1G_02595
Accession: gb|EAU81579.1| Score: 540 E_value: 1e-53
KEGG Definition: hypothetical protein
Accession: ani:AN8527.2 Score: 532 E_value: 6e-53
KOG Definition: No Hit Found
PFAM Definition: DJ-1_PfpI, DJ-1/PfpI family. The family includes the protease PfpI. This domain is also found in transcriptional regulators..
Pfam Number: pfam01965 Score: 131 E_value: 1e-08

Sequence:
>SY0AAD9YK02FM1
CTCGCCCCAAATGTAACCGACAAAAGCGTACATGGCGTCCATCCCCGCGG
CGATCCCCGATGATGTCCATATGTTCCCGTCGACCACCCACCTCGCCTGC
GCCACCCAATTCACCTTCGGCCCCTGACTCGTCACCCACGCCCACAACTT
TTTATTCCCCGTCGCGCTGCGGCCATCGAGTAGGCCCGTCGGCGCAATTA
GCGCCGACCCTGTGCACACGGTCATGAGGTACTTTAGCGACGGGTATATG
TTCTTGACGAATTCGCGGGTGGACTCCAGGCCCGGCGCACGGGAGCCCAG
GCCGCCCGGGACGAGGAGGAAGTCGAGGGGGGGGACCGTGGCGAAGGTGT
GGGTTGGCACAATGCTCTCGCTGAATTCCGAGCCTGTGGTGTTGGTTATG
GGTACCTTTGTTGACACGGGATCGAGGGTTTCGGCGATTATGTGGAGATT
TAGCTTCTCCGAGAAGGCGAGGGTGTTTAGGACATCGATGGGGCCGAAGA
CATCCAGAGCTTGGAAGCCCGGGTATAAGAGGATGCCGAAGGTAGCCGGA
ATTGCTGATGGGGTCAGGTTAGTGATCAGTATTGATTGTCAGAATTGGGG
AGGGATGGTAGCTACGTTTCTCATCAGCGCAAGTGGCAGTGTTTACGGAA
GTGGCAGCCATAGTTGCAAAGACTATGGTCCGAA

Sequences in the Contig:

SY0AAD9YK02FM1