Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD9YJ24FM1
Length(NT) : 671
Best Gene Model Blast : Link to GSTUMT00001813001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE63146.1| Score: 280 E_value: 2e-23
KEGG Definition: ankyrin repeat
Accession: aor:AO090113000090 Score: 280 E_value: 1e-23
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAD9YJ24FM1
TTGGTCCGTTCTTCCTCACCTCATTGTTAATTATCTCTACGAGTATCGAG
GAACACGCTCAATCCCTACGTTCACAAAACGCAACCTTTGAGAATTCAGA
AATCCAGGGGAAAAAATGGGCAATTGGCTCTCAAGCATTCCATTTGAGGG
GTATACTTCTAACTAGAGTGTCGCTCGCGTTTACTTGCCCTTCTATCCAC
TAATGACTGTTTCTATGGCTCAAGCTTGTCGGCGAACAGTCATATTGCCG
GTAGCTGTAGTGGCAACAGCGATTCTAATAATATCACTATCAATAATTAC
GGAAGTTCGACTTCGTCCGAGACCTGCGCAGAAATTCTGCAATGCCTATA
CACATCGGTATACTCGGAGCACAGGCGTCGGGTTAGGAAACCAGTCGAGG
GAACGTGCGCTTGGGTCATAGAACATCCAAAGTATAAGGAGTGGTTGGAG
AATAAAACTTCCGGTCTCCTATGGTTATCGGCGGATCCGGGTTGCGGAAA
ATCGGTCACCGCTTCATTCCTCATTACACATTTGGAAAGGGAAAGGAACA
CTACTATTTGCTACTTCTTCTTTAAGGACGACAGCGAGGAACAGAGGAGC
GCAAAATATGCTCTTTGCGTCATACTGCATCAGCTTTTTTCGAAGCAAAA
CTCGCTCTGCAAGTACGCTGA

Sequences in the Contig:

SY0AAD9YJ24FM1