Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD9YG13FM1
Length(NT) : 626
Best Gene Model Blast : Link to GSTUMT00000478001 E-value : 1e-163
Numbers of ESTs : 1

Blast Results:

Nr Definition: kinesin family protein
Accession: ref|XP_001260935.1| Score: 338 E_value: 3e-30
KEGG Definition: kinesin family protein
Accession: afm:AFUA_2G14730 Score: 321 E_value: 1e-28
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAD9YG13FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCGAGAGAGAGCCGTCAGGG
GAGTCCAAGGAGGAACTCAGCAGAAACACCGGAAAGGGCACTATTGAGCG
AGTCGATTGCGAGCGAAAGCGCCGCCCCAAGAGGACAGGATCCACATGTA
CATGTGCTACGGAGATATGTGGATTTGTGGTCCTCATGGAAAGACCCCAG
CGAGAATATACTTGTCCGACAGAACACGGAACCTCCACAGGATGCAGCTT
GCTTTGCTGAGCCAACAGAAGCTGACCCTCCGCGATTGATTGCCGAGGTC
CGGCAGATTCCCAAAAGGTTTATTGATCCAAGTACAATTAAAAAATACAC
TCTCTAATGTGCTCCCCTCCTGTATAGTACCTCAGTGTTGAAGTCGGGTT
ATCTGTTTGTGCCAGATGAATCCAATAAGGCATGGATCAAGAGGTACTTT
GAACTGCGACGGCCCTATCTGCATGTTCACTCGATCACAGACGGAGAAGA
AATCACAGCCATCAATCTCACCCACTGCCACATCGACCATAACCCTCACG
TTCGAAAACTCCTAAGAAGACAGAACAATAATATATTTGCTCTGTACACA
CCGCTCAATACCTATCTCTTCGGGGC

Sequences in the Contig:

SY0AAD9YG13FM1