Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD9YF21FM1
Length(NT) : 514
Best Gene Model Blast : Link to GSTUMT00000796001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein LELG_04154
Accession: ref|XP_001525122.1| Score: 157 E_value: 2e-09
KEGG Definition: hypothetical protein
Accession: dha:DEHA0G25817g Score: 155 E_value: 2e-09
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG1049 Score: 144 E_value: 2e-10
PFAM Definition: Fip1, Fip1 motif. This short motif is about 40 amino acids in length. In the Fip1 protein that is a component of a yeast pre-mRNA polyadenylation factor that directly interacts with poly(A) polymerase. This region of Fip1 is needed for the interaction with the Yth1 subunit of the complex and for specific polyadenylation of the cleaved mRNA precursor..
Pfam Number: pfam05182 Score: 127 E_value: 2e-08
Swissprot: Q6BGR9|FIP1_DEBHA

Sequence:
>SY0AAD9YF21FM1
TTGGCGGATTACTTCAACTACGGCTTCGACGAGTTTACCTGGACAGCATA
TTGTCAGAAGCAAGAGTCCATGCGGGAGGAATTCGATCCGAGGAAGATGA
TGGAGCAGATGATGTTACTCTCAGGTATGACTGGGGGATTGGGAATGCCA
GGGATTGTTGTTGACCCGTCTGCTGTTAATGTTGGTGTTGGGGGGATGGA
CATGAATACTGCAGCGGCTATGATGGCTTTCAATCCCACTGGAGGGGGAG
GCAGCAGCGCCACCGGCGGGGCACCGACAACAGCAGTCGGTACAAGTGCC
GGTGGGACGGATATGAGTATGGTTAGTGGGATGGTTGACCCGTCCATGTA
CGGGGCTGGTCCGATGGGTGGGGGATACGATGACAGGAGCGGCGCCGCTG
CCGGGGCGTACGGAATGGCGGCTGATCCGAGGAGAGCTGGGATGCCACCC
CAAGGACCGCAGCAGGCGATGGGTGCATACGGCTACGACCAGAGTATGAT
GCAACAGCAGCAGC

Sequences in the Contig:

SY0AAD9YF21FM1