Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD9YF09FM1
Length(NT) : 564
Best Gene Model Blast : Link to GSTUMT00009280001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_07190
Accession: ref|XP_001591744.1| Score: 220 E_value: 1e-16
KEGG Definition: MYND domain protein, putative
Accession: afm:AFUA_1G03000 Score: 206 E_value: 3e-15
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAD9YF09FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCGCAGAGAGATCTGTCGTTT
GCCGGTGACGGTGATAGATCCTCGGATAAGCATCTGGGAGTCTATGCCAA
GGAGGATATATTCCTAGGCGAGACCTTCTTCAGCGAGGCATCCCCTCTAA
CGGTCGTTGCTGATCCTGAGAATTCTAGCCTGTGCGAGTACTGCGGTGGG
AATCTGCCGGATCAGTATGAAGTCTGCGACGACTGTTGGGAGGGGGACGA
AGACAGCGGCGTTATGTGGTGCTCGGAAGAGTGCAGGCAGAAGGCGTTCA
AAAGTTATCATCCCGCGCTCTGCGGGAGGGACTTTACGTGGCTGTATCGC
GATGTTAACGCTACGGCAAGTTCCAATTCTGCGTACTCACTGCTTCTTCT
AAAGACATTCGCTATGGCTCTCACCCTAGATGTCCATCCCCTTGCACTGC
CCGATGTGAAATACCTATACGGCGTCTCCCGCCCACCACTAAAACACATT
CCGGCTATTGCCCTACCATTCAACTTTACCCATCAGGTCCTCCAGCCTAT
ACAGATGCTCCAGG

Sequences in the Contig:

SY0AAD9YF09FM1