Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD9YE15FM1
Length(NT) : 738
Best Gene Model Blast : Link to GSTUMT00004679001 E-value : 1e-142
Numbers of ESTs : 1

Blast Results:

Nr Definition: ATP-dependent RNA helicase
Accession: ref|XP_001222580.1| Score: 211 E_value: 2e-15
KEGG Definition: hypothetical protein
Accession: yli:YALI0A11157g Score: 210 E_value: 2e-15
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG0329 Score: 267 E_value: 2e-24
PFAM Definition: No Hit Found
Swissprot: Q2H4D0|SUB2_CHAGB

Sequence:
>SY0AAD9YE15FM1
TTGGCAGCTATTTCTCATCAGTCTCGACTTCTGCCCTCCTTCTTAGTGGA
AGGATATCTCTTAGTCGATCGTCTTTCTTCTTCCGCCTTTTCTTCTTTTA
TTCCTCTTCGCACTTTTACGAACCCTTTACGATTCCCTTCACCCACCTCT
ATCCTATCTTTTTTCCCTTCTAAAAACACCAACCTCTCTTGACGAGCATC
ATGTCTGGTGAAGAAGATCTCATTGACTACTCCGACGACGAGGGTCTTGA
TGCCACCAAAGAAACCCCTTCCGTTGCCGCTAACGGGGAAGCTGCGGCCA
AAAAGGCTGACGTGACTGCTGCCGCCGGTGGTCCTGCTGCCGACAAAAAG
GGCTCTTACGTCGGCATTCATTCTACTGGTTTTCGCGATTTCCTTTTGAA
GCCTGAGCTGCTCAGAGCTATCGTCGACTGCGGTTTCGAACATCCTTCCG
AGGGTCAGTTTTTCCTCCTCCCTACATCATGAAAGCAATATTACCCTCTT
TTATCACTCCTGTCTTCTTTCTGCATACTACGCGTCGCGTCTTCGTGGTG
GTCTTCTCGTCGTCTCTCGTCTGGGTAGTGGTTACATTCTCGCTTAGCTC
TGTGGAGCATGGGAAAGGGTGGAGAAAATTGAGGCCAAATCACCTTTGTT
TGTGATTGGTGTATGCAATCACATTCAAGCGGTAAAGAAAGTCGCCTTGC
TTAACGATACCCGAGGACATCGTCGCGACTTTTTTTGT

Sequences in the Contig:

SY0AAD9YE15FM1