Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD9YE14FM1
Length(NT) : 683
Best Gene Model Blast : Link to GSTUMT00001007001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein NCU06252
Accession: ref|XP_962856.1| Score: 365 E_value: 3e-33
KEGG Definition: hypothetical protein
Accession: ncr:NCU06252.1 Score: 365 E_value: 1e-33
KOG Definition:
Classification: [Defense mechanisms].
Kog Number: KOG1716 Score: 108 E_value: 4e-06
PFAM Definition: DSPc, Dual specificity phosphatase, catalytic domain. Ser/Thr and Tyr protein phosphatases. The enzyme's tertiary fold is highly similar to that of tyrosine-specific phosphatases, except for a "recognition" region..
Pfam Number: pfam00782 Score: 121 E_value: 1e-07
Swissprot: O13453|PMP1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0017017 = Molecular function: MAP kinase tyrosine/serine/threonine phosphatase activity
GO:0005515 = Molecular function: protein binding
GO:0006470 = Biological process: protein amino acid dephosphorylation
GO:0000749 = Biological process: response to pheromone during conjugation with cellular fusion
GO:0032005 = Biological process: signal transduction during conjugation with cellular fusion

Sequence:
>SY0AAD9YE14FM1
TTGGCAATGGCATTCCAGGTGGCATGCGATTACCTCTCACCCCAGGTTTC
AGGCAGCCGCGGTTGTTTCAACCGCGTCACAGCTTCAACTCTTGCAATGC
ACGTGACGCTTTGTCAACTTCCCCCTCCTCATCAACAACTAATTCGCCCC
CCAAAAGTCCTGAGGTGTTACATGAGATGGACGAGGAAGATGAGGAGCCA
AGATCTGGAGAAGCAAAATCGCCTGCCTACCCTTCCGGCCCTGTTTGCAT
TTTTGATCCTAATATCTATCTATACGCCGAACCTGATGCTGAGCTCGCAT
CGCAATTCGATGTTATTGTGAATGTAGCGAGGGAGGTCGTTAACCCGTTC
AAGACAGATAAAAACTTGACTGCCGCCAAGGCTGCACTAGGCGCCAACTG
CAAGGATGCGGAGTCGGACTCACTGCCACCTGACACCGCCTGCACGGAAG
CAAGTTTTACAACCGCCTTTGAGGAAGCCTTATTTTCCCCCGTACTAGCG
TCCTCCCGCAGGCCTAAATTAGACGCACTAGGACCAAAACACAAGCAGCC
CGAGTATGTGCATATGCTATGGGATCATAATACACCAATCCTAGACGATT
TGCCTCATTTGGTGAACCTGATTAACGACAGAGCGAGCGCAGGAAAGAAA
GTGCTTGTTCATTGTCAATGTGGCGTTAGCCGT

Sequences in the Contig:

SY0AAD9YE14FM1