Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD9YE12FM1
Length(NT) : 660
Best Gene Model Blast : Link to GSTUMT00008433001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein An15g04470
Accession: ref|XP_001396982.1| Score: 444 E_value: 2e-42
KEGG Definition: hypothetical protein
Accession: ang:An15g04470 Score: 444 E_value: 9e-43
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAD9YE12FM1
TTGGTAAATTTCGAAGGATGGACATGGAGCAGAAGCCCCGCCTGATACAC
TTCCAGCTGCGCAATCTACTAGGAGTGGTGTCCAGAAGCGATGTTTTCTA
CGCTGGTAATGCGAAGGTTCTCCGGACAAATCCGCTAACAGGATCGACGG
TGACTACTATGGATCTATCGTACCCGGACTCCTGGAGCGGGAATCAAATC
CGAATATCAACATTGAGTGCCTGTGCCGGTCAGTCTGGTGTAGTGATCGC
AGGCTGCTTTCATGGGGAATATGCTATGAAACCGCTCTTTGCCCAGGCAT
CCGCGAAACCCATCACGGGGATTGTGACGAAGAATGAGAGTGGCATAACA
AACCACGTTCAGATTGTCCGAAACAGACACAACAACACACCAAATGCCGT
CTTCTCATCAAACGATTGCCACGTGCGTGTCCTTGACTGTGAGACTCTAG
CTTTCAACACTCAACACGAATATGACTGGCCGGTGAACTGCAGCGTTACG
AGCCCAGACTCGCGCTTGCGCGTCGTGGTAGGGGATCATACAGACGTGCT
TATCTGCGACGCCGAGCGCGGGAGCACACAGTTTGTCCTCCCAGGACACA
GAGACTACGGTTTCGCTGCGGCCTGGAGCGACGACGGGCACACTATTGCC
ACTGGGAACC

Sequences in the Contig:

SY0AAD9YE12FM1