Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD9YE05FM1
Length(NT) : 648
Best Gene Model Blast : Link to GSTUMT00010672001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001209909.1| Score: 467 E_value: 4e-45
KEGG Definition: ribonucleases P/MRP protein subunit [EC:3.1.26.5]; K01164 ribonuclease P
Accession: aor:AO090120000111 Score: 457 E_value: 3e-44
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG3322 Score: 177 E_value: 4e-14
PFAM Definition: POPLD, POPLD (NUC188) domain. This domain is found in POP1-like nucleolar proteins..
Pfam Number: pfam08170 Score: 234 E_value: 1e-20
Swissprot: P41812|POP1_YEAST
Gene Ontology:
GO:0005655 = Cellular component: nucleolar ribonuclease P complex
GO:0000172 = Cellular component: ribonuclease MRP complex
GO:0006379 = Biological process: mRNA cleavage
GO:0006364 = Biological process: rRNA processing
GO:0008033 = Biological process: tRNA processing

Sequence:
>SY0AAD9YE05FM1
TTGGAGAAGTACAAGAGACAATTTTTAGAGTTACTTCCACCTGGTCAATC
GACAGAACACAACCCCCGTCATCCCTATTCTCGAGGGAAGCCAGAGCTGT
TGCTGTCAAGTCACAATCGTCACAAAAGAAGATTAACAAGAGAAAGGGGG
AAGCCGTTCCGGGAGAATATCCATCGCCCCTCCCTACAGATCCTAGGATT
CCAATTGTGCTTTTAGCCACCCGCCGCTCATCTGCTGAGAAAGGAGTTTC
GGGAGCTATTGGATCTTGGACAATTTTATTACCATGGAAGTGGGTGCAAC
CGGTATGGTATGGTATTGTGCACTCTGGCTCAAGCGTCAAGTTTGGCGGT
TTAGACGAATCGCGGCAGATCAACTACGAAAACTCTAACAGGCATTTTCC
AGATGATTTTCCCGGAACAAAGGCTGGGATCGTGGAGGAGCTTAGGAAAG
GGGTAGAAAGGAAGGAGTGGTGGGATAAGCGGCCAAAGGGGAAGAAGGTA
GTGTGGGGTAGTGTGAATATTGGAAATAAGAAGGGAGAGGTTGGAGATGG
GTTTGTGTGTGATTGGGCATACTTGCTGAAGGGGAAGAAGATTGATACTA
CTCAGGGCAACGACTCGATCGAGTTATCTACGGATACTATCGAGTCCA

Sequences in the Contig:

SY0AAD9YE05FM1