Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD9YD20FM1
Length(NT) : 671
Best Gene Model Blast : Link to GSTUMT00009784001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_05441
Accession: ref|XP_001556070.1| Score: 665 E_value: 2e-79
KEGG Definition: permease of the major facilitator superfamily
Accession: aor:AO090005000280 Score: 588 E_value: 5e-74
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG2533 Score: 265 E_value: 3e-24
PFAM Definition: MFS_1, Major Facilitator Superfamily..
Pfam Number: pfam07690 Score: 124 E_value: 6e-08
Swissprot: Q10097|YAOI_SCHPO
Gene Ontology:
GO:0005783 = Cellular component: endoplasmic reticulum

Sequence:
>SY0AAD9YD20FM1
TTGGCAGATTTCCCGGAAGAAGCATCATTCTTATCAGAAGATGAGAGAGA
ATTCGTCAAGGCAAGGCTTCTAGCAGACGTTGGTCACTCGGGAAGGGAAA
CGGACCTAAGGGTTAAAGATATTCCCGATGTCTTTAAGGATTACAAAATA
TTTGTGGGAGGATTGATGATATGCATACTTTGCTCCCACAATCCTTAAAG
ACCTGGGATATTCTGCTATCCAAACACAACTGCGCTCCGTGCCTCCTTGG
GTTTGCGCCTTCGCCTTCGCCATGACAATTGCTGCAATCTCCGATCACTT
GAAGCGCCGCTTCGCCTTCACCATGCTTCCGATACTTCTAGCCATCAGTG
GTTTTTCAGTCCTGCTTGCAGTTCATGATAACGTAAAAGTGCAATATACA
GCTCTATTTCTCGTTGCGATGGGTTGCTACAGTGCGATGCCAGTCATAGT
ATGCTGGTTCAACTTGAATCTCGGAGGCCACCGAAGGAGAGCAGTAGGCA
CCGCCTGGCAGATAGGCTTCGGAAACATCGGAGGAATCATCGCTACGTAC
TCATTTATCTCCAAAGACGCTCCGAGATACACCAAAGGATACGCAATATG
TCTTGGATTCGCCTGTCTATCAGCCATATCGTGCGTGGTTTACTACATCG
CCATAACAAGAGAAAATATGA

Sequences in the Contig:

SY0AAD9YD20FM1