Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD9YD10FM1
Length(NT) : 696
Best Gene Model Blast : Link to GSTUMT00009508001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein HCAG_04010
Accession: ref|XP_001541912.1| Score: 603 E_value: 7e-61
KEGG Definition: hypothetical protein
Accession: ang:An02g01420 Score: 595 E_value: 3e-60
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG1870 Score: 406 E_value: 1e-40
PFAM Definition: UCH, Ubiquitin carboxyl-terminal hydrolase..
Pfam Number: pfam00443 Score: 308 E_value: 3e-29
Swissprot: O60079|UBP12_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0016579 = Biological process: protein deubiquitination
GO:0006511 = Biological process: ubiquitin-dependent protein catabolic process

Sequence:
>SY0AAD9YD10FM1
TTGGGGTGAATGGATCAGCGAGAAACCGACCAAGTCGGTTAAGAAGGGCG
GTCAGCAGGTTACTGTGGCTCTGAATGGAAAGAATATCACGGGGGGGCCG
GTGAAGAAGAAAGCTTCCGCAAGGCCGGACAGCCCTTCTGGGAGTACTAG
CACAGCTGTTATCAGATCCGGATTTCTCAATAGACCTGCAGAACGTCGGG
ATGGCAGACCCTTAGGTAAATGTGGGCTGAGCAACTTGGGTAACACCTGT
TACATGAACAGCGCCCTGCAGTGCTTACGCAGTGTTACCGAACTGTCTAA
CTACTTTCTCTGCAATAAGTATATGGAGGAATTGAATCCTAGTAATCCAC
TTTCTCATAGCGGGAAGGTAGCAAAGGCGTATGCGACTCTTCTCGGATAT
ATCTTCTCGCCAACATGCCCTGTATCGGTATCGCCCAGGGAGTTCAAAAG
CACCATCAGTCGCTTTAGCCTGTCGTTCTCGGGATATGGGCAACAGGATA
CTCAAGAGTTTCTGGCGTTTCTCCTCGATGGTTTGCATGAGGACCTTAAT
AGGATTCAGAAGAAGCCATACATTGAAAAGCCAGAATCGACCGATAAGAT
GGTTGGAGATGGCGAGGCGATTGCAAGGCTTGCCCAGGAGCATTGGACCA
TATATAAGCGGAGAAACGATTCAGTCATTGCGGATTTGTTTGGTGG

Sequences in the Contig:

SY0AAD9YD10FM1