Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD9YA05FM1
Length(NT) : 744
Best Gene Model Blast : Link to GSTUMT00012251001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_10681
Accession: ref|XP_001550796.1| Score: 596 E_value: 6e-60
KEGG Definition: hypothetical protein
Accession: ang:An15g01520 Score: 544 E_value: 3e-54
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: A2R4T4|SEC16_ASPNG
Gene Ontology:
GO:0005789 = Cellular component: endoplasmic reticulum membrane

Sequence:
>SY0AAD9YA05FM1
TTGGAAACCCAGAAGTTGTGAAGGCTGTCAGGGTTATCTTGTCACCGGAA
ACGGTCGGAGAAGAAGGCATGAGCGATCATGGAGCATTTTCTGCTGCGGG
AGATATATCTTCGACCGCACAGGGCCCAAGTATTGAACGGGCTGATCCCC
AAGCCGTCAAGACTATTAAGAATAATCTCCTCAAGGGTGACCGTGCAGCA
GCTGTTTGGCATGCCGTGGATCGCAAGCTATGGTCTCACGCGCTGCTGAT
ATCCGGGACCGTTGGTCGTGATTTGTGGAAGCAAGTAGTTCAAGAGTTTG
TGAAGAACGAAGTCAAGACACTCGGTGAGGATGCAGACAGTCTGGCTGCT
CTCTACGAAACATTTGCTGGTAACTGGGAAGAATGTGTTGATGAGTTAGT
GAGCGCTAGCGCTAGGATGGGGATGCCGATGCTTGGTGGTGGTGCTTCGC
GCAGCGGAAGCGTAAATATCGATGAGAAGCTTGGCCGGTGGAGGGAAACA
TTGGGCTTGATTCTAAGCAATAGGTCACCGGGCGATGTAGAGTCAATAAT
GGCACTGGGGAAGTTGTTGGTTGGATATGACAGAGTTGAGGCTGGCCACA
TTTGCTATCTATTTGCTCGCAAAGGGGCCCCGGGTAGCACAGGATCTGTT
TTTAGTGGACACGATGATCCGGCCGCTGATTTCTCGCTCCTGGGCGCAGA
TCACCGTCAGGCGCCATTTGGGAGAGACGCCGACTCGGTCATGC

Sequences in the Contig:

SY0AAD9YA05FM1