Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD8YP11FM1
Length(NT) : 441
Best Gene Model Blast : Link to GSTUMT00001880001 E-value : 8e-39
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein NEMVEDRAFT_v1g155353
Accession: ref|XP_001618200.1| Score: 228 E_value: 9e-18
KEGG Definition: NEMVEDRAFT_v1g155353; hypothetical protein
Accession: nve:NEMVE_v1g155353 Score: 228 E_value: 4e-18
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q8TGM6|TAR1_YEAST
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion

Sequence:
>SY0AAD8YP11FM1
TTGGGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCT
AAATATTGGCGAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGA
AAAGCACTTTGAAAATAGAGTCAAAAAGTACGTGAAATTGTTGAAAGGGA
AGCGCTTGAGACTGTCTTGGACTCAAGCTCTCGTTTAAACCACCCGCCCA
AAAAAGTGCCAGGTCCGCCTCACGGTCCTTATTTTGTGCCTTACCTTTTC
GAGGAGTCCCGCCCGCTTTTCATCTCTCGAATCCGGGCCTTCTTTTCTTT
TTTACATACACCATCCCCTCTAACCTTGTCTGTTGGGCCCTTTCCCTCAC
TCACCCTATCGACGATCTCCCACACCCTCAACGCAAAAACCCGCTTGGTG
GGATTGGTTGTGCTAACAGCCTTCGTGGAAGTCATTCCCAT

Sequences in the Contig:

SY0AAD8YP11FM1