Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD8YO21FM1
Length(NT) : 676
Best Gene Model Blast : Link to GSTUMT00009566001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_06050
Accession: ref|XP_001593128.1| Score: 689 E_value: 7e-71
KEGG Definition: hypothetical protein
Accession: fgr:FG07422.1 Score: 672 E_value: 4e-69
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG3745 Score: 176 E_value: 6e-14
PFAM Definition: No Hit Found
Swissprot: O74854|POF6_SCHPO
Gene Ontology:
GO:0000935 = Cellular component: barrier septum
GO:0051286 = Cellular component: cell tip
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0005515 = Molecular function: protein binding
GO:0000917 = Biological process: barrier septum formation
GO:0000920 = Biological process: cell separation during cytokinesis

Sequence:
>SY0AAD8YO21FM1
TTGGTTCATGAGCAACATCAACCGAGAAGCAGATAAGCGCGATTTTCTAT
CGACGTTCAAAAAGGTTATTCTCATGCCCGTTTCGGTTATTCCATCCCCT
TTCTCAGCAAAGTCAACTCCTGCTGCCGAGACAAAGCCTGCCGAGACAAG
CTCATATGCGAATTCAGACACACTCAGCGTACAGGAGACCCTCAATGCAT
CTCGTCCTGGCACACCTATGACGCTAGGGCAGGCTACTCCTGGGCCACCG
CCAACCACCGAGCTGGCTGCAAAGGCAGCAATCATGAATTCTAGACTAGA
AGGGATTCGGTCATTGTTCAGTCTGGAGGTCGCGTTGAACCTCGTGCATT
CCGCCAAGTCTAGTCTCGAGAGGGCTGCGTTGTTTGCTACTGCAGGTGGG
CAGACTGGAGAAGAAGCCCGCGAGCAGTGCGAGCAGATATTCATTGCACT
ACTTCGAGTGCTAGGCCCACGGCATGTGAAGGCTGGCTTTGACAAAGCCG
TTGAACATTTATCGAAATATAACCCCCGAGAAATTACGGAGCACTCTCAG
CCTGGAGTAGCACCCCTAGTTACATTTTTAGAGTTAGTCAACGTCGGCGA
TCTTATCCAACAAATGATAGATGTATTTTATGAGCAAGAGCTCGTAGCAG
CGAAGCTTACAGATCCCAACGATTTC

Sequences in the Contig:

SY0AAD8YO21FM1