Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD8YL23FM1
Length(NT) : 646
Best Gene Model Blast : Link to GSTUMT00006303001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein AN8767.2
Accession: ref|XP_682036.1| Score: 196 E_value: 1e-13
KEGG Definition: hypothetical protein
Accession: ani:AN8767.2 Score: 196 E_value: 5e-14
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG4412 Score: 152 E_value: 3e-11
PFAM Definition: No Hit Found
Swissprot: O15084|ANR28_HUMAN
Gene Ontology:
GO:0005515 = Molecular function: protein binding

Sequence:
>SY0AAD8YL23FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCAGCTCATCCTCCACATCGC
GGGCTACCAATCCCCACCGACGGTCTTCTCCCTCCTGCGAACAAACCGCA
CACTCCATTGCCTCCTCACGGACGCACTAACGGACAGCGTATTCAACGAC
CTAACCTACGCCTCAAAAGCCATATACCACGCCGCGGAGCGGGGCAACAA
GCGCATGATCCGGCGCCTGGTGAACTCGGGCATCCTGAAGGACATAGACT
TCAGCCTGAACGCAGCGGTGTCGTACGAGAGCCCCGAGGTGATCAAGACG
CTGCTGGACTGCGGGGTACCGGCCAACACGCGGGACGATTGGGGCGAGAC
CCCGCTGATCGTCGCGGCGATATCCTGCCGTGTGGAGATCGTGAGACTGC
TGGCGCAGAGGGCGGATGTGGACGTCAATTCCACCGACTGGCGGCATACC
ACCGCGCTCGCGTACGCCGTGCGGGATAAATTCGGTGGCGGCGTGGAGGT
CGTTCGCGCGCTGCTCGAGCGGCCGGATACGGACGTGAACGTGCGCGACA
TCGACGGTCGCTCGGCGCTGCACCACGCCGCGGAATTCGGTGGGCGGGAG
AATGTGGCGAGCTTGCTGGCGCGGCCGGAGGTGAATGTGAATTTCG

Sequences in the Contig:

SY0AAD8YL23FM1