Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD8YL10FM1
Length(NT) : 600
Best Gene Model Blast : Link to GSTUMT00004090001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein An15g06030
Accession: ref|XP_001397132.1| Score: 341 E_value: 6e-46
KEGG Definition: hypothetical protein
Accession: ang:An15g06030 Score: 341 E_value: 3e-46
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG2903 Score: 340 E_value: 5e-33
PFAM Definition: No Hit Found
Swissprot: P36156|GTO2_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0004364 = Molecular function: glutathione transferase activity
GO:0007047 = Biological process: cell wall organization and biogenesis
GO:0009636 = Biological process: response to toxin

Sequence:
>SY0AAD8YL10FM1
TTGGAGTCTACCTCTGGTCAGAAAATCACCGATTGGGTATCTACAGTGTG
GTTTCCCTCCACAGGTTGGTTGATCACTACTAACTGACAACAAGGACTCT
AAACGTGGGGAATTCAATCGCAAGCCCTCAACTTTCTGCGACCTGGTTTC
TCGTGAGCCCAATGCCAAATTCCCTCCTGAGAGAGGTCGCTACCACCTCT
ATGTTAGCTATGCCTGCCCATGGGGTCGGTCACTTTATCCGATATGAAAC
GCTTGTACTAACAACCCTTAGCACACCGAACCCTCATCACCCGCGAGCTC
AAGGGCCTACAAGACATAATTGGTGTTAGCGTAGTGCACTGGCACTTGGG
AGAGAATGGCTGGCGTTTCGGTACCACCGAGGAGGCCGGCGAGTATCCAG
AGGTGGCTGTTGGTCCGGAAGCAAACACTGGGGCGTCATTCCTGAGGGAT
ATCTACTTCAAGGCCCAGCCAGATTATGATGGTCGCTACACGGTGCCTAC
GTTTTGGGATAAGAAGAATAACACTATCGTTTCCAACGAGAGTAGCGAGA
TAATCAGGTTTTTATATACGGAGTTTGATGACCTTGTTGATGAGAGCAAG

Sequences in the Contig:

SY0AAD8YL10FM1