Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD8YL06FM1
Length(NT) : 487
Best Gene Model Blast : Link to GSTUMT00001595001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE61550.1| Score: 306 E_value: 8e-27
KEGG Definition: predicted protein
Accession: aor:AO090102000523 Score: 306 E_value: 4e-27
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG3372 Score: 296 E_value: 4e-28
PFAM Definition: SPC22, Signal peptidase subunit. Translocation of polypeptide chains across the endoplasmic reticulum membrane is triggered by signal sequences. During translocation of the nascent chain through the membrane, the signal sequence of most secretory and membrane proteins is cleaved off. Cleavage occurs by the signal peptidase complex (SPC) which consists of four subunits in yeast and five in mammals. This family is common to yeast and mammals..
Pfam Number: pfam04573 Score: 289 E_value: 3e-27
Swissprot: Q6C4R5|SPC3_YARLI

Sequence:
>SY0AAD8YL06FM1
TTGGCTAAAGGAAGGGCGCACCAATACTACACATCGAAAGTGCAGGAGTA
TGCGGTTTTGTATTTCGATTTGGAGGCTGACCTCTCCTCCCTCTTCAACT
GGAATACAAAGCAGGTATTCGCATACGTGTCTGCGACGTATCCGGGGTCT
AAATATACTGATAACGAAATCGTGATCTGGGACACTATCCTTCCATCCCG
CTCTGCTTCGAAGCTGATCTTGAAGAACGAGCGCGCAAAGTACAGCATCA
ATGATATTACTGGGAAGTTCGCCGGCCGCGACAATGTTACCCTGTCGTTT
CATTGGAATGTTCAGCCGCATGTGGGCAGACTGACGTGGGGGGCTGTGGG
GCTCACGAAGGGGGTTAAGTTTCCGGGGGTGGAGAGGCCGGGGGGGAAGA
AAGAGGCTGCGAAATAAGGGATTGGTGAGAGGGAAAAAGGGGAAAGGGGG
GGGGTTGCTTTGTATGATAGGGTGGAGAGGGGGGGGG

Sequences in the Contig:

SY0AAD8YL06FM1