Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD8YK07FM1
Length(NT) : 625
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_08138
Accession: ref|XP_001240975.1| Score: 339 E_value: 2e-30
KEGG Definition: diadenosine polyphosphate hydrolase and related proteins of the histidine triad (HIT) family
Accession: aor:AO090026000478 Score: 336 E_value: 3e-30
KOG Definition:
Classification: [Nucleotide transport and metabolism, General function prediction only].
Kog Number: KOG3379 Score: 395 E_value: 2e-39
PFAM Definition: HIT, HIT domain..
Pfam Number: pfam01230 Score: 234 E_value: 9e-21
Swissprot: P49776|APH1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0004081 = Molecular function: bis(5'-nucleosyl)-tetraphosphatase (asymmetrical) activity
GO:0006154 = Biological process: adenosine catabolic process

Sequence:
>SY0AAD8YK07FM1
TTGGTCTCAAGCTCGGTCGATCGAGGCCGGAAATTGAGACGGGGAACTCA
TCAGAGGGAAACCATCAACGGCGGTGACATTGTCATCCCGAGCAGCGTTT
CGTCGCAACTTCATCGACCTGGGCTGGAAGCTAGCTAGCTGAGCCCCGGT
CGGCCAAATCCCTGTTCTCATTTCAACAACGACGCCCTGGTGTACGAAAT
ACACAGAACATGCATGAGGCCCCGACCCCTTCATCTGCAGCATCCTTGAC
ATCGGCATCGAAACCAATGCCGCTGCCGCCGCTCAACCTGCCCGCGAGCC
TGAAGTTCGGCCCCTTCGCCATCTCCGGCCAGGTCTTCCACCTGTCGCGC
TCGCGGCTGACGTATGGCCTCGTCAACCTCAAGCCGCTGCTGCCGGGCCA
CGTGCTGATCTGCCCCGTCCGCTCCGTGCCGCGGCTGTCCCAGCTCACGC
CCACCGAGACGGCGGACCTGTTCAACACGGTGCGGCTGGTGTCGCGGACG
ATCGAGCGGGTGTACCGCGCGACGGCGCTCAACGTCGCGGTGCAGGACGG
CGTCGACGCGGGCCAGTCGGTGCCGCACGTGCACGTGCACGTGATCCCGC
GGCGGGCGGGCGACCTGGACGACCG

Sequences in the Contig:

SY0AAD8YK07FM1