Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD8YK02FM1
Length(NT) : 594
Best Gene Model Blast : Link to GSTUMT00003937001 E-value : 1e-141
Numbers of ESTs : 1

Blast Results:

Nr Definition: 40S ribosomal protein S23
Accession: ref|XP_001243230.1| Score: 398 E_value: 3e-37
KEGG Definition: AAR108Cp; K02973 small subunit ribosomal protein S23e
Accession: ago:AGOS_AAR108C Score: 396 E_value: 3e-37
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG1749 Score: 403 E_value: 3e-40
PFAM Definition: Ribosomal_S12, Ribosomal protein S12..
Pfam Number: pfam00164 Score: 219 E_value: 6e-19
Swissprot: P32827|RS23_YEAST
Gene Ontology:
GO:0022627 = Cellular component: cytosolic small ribosomal subunit
GO:0005515 = Molecular function: protein binding
GO:0003735 = Molecular function: structural constituent of ribosome
GO:0006450 = Biological process: regulation of translational fidelity
GO:0000723 = Biological process: telomere maintenance

Sequence:
>SY0AAD8YK02FM1
TTGGGGGGACAACTTTGTACAAAAAAGTTGGCTGCACCCTACATCAAATC
AAATAACCCAACACCGCGTCCCGGAGGAAAAATAAAGAAAATCTAAGACA
TACCGAAGGCAGTCACTTTCTTGCTGTTCTTGATAAGCTGAACCCTCACA
CACTTTCGGATAGCGGAGTTTGGCTGTTTGGCCTCGACACCAACTTTTTC
GAGGACGATTCCCTTCGCATGAGAAGAACCACCAAAGGGAGAAGACTTGA
AGGCGGTTCCGAGGAGCCTCTTCTTGAATGACTGATCAGCCCAGCGGTTA
TCACGTCGGTGGGTTCGAAGCTTGCGAGCGGCGTTGAGTCCTCTTGGTTT
TCCTCTAGAAATTGCGAGAGAGAAAAAGGAGTGGTCAATTGTGTTGACGG
CTGAAAAGGTAATGGTGGCGGTTGTCGTAGGCTGCCGTTGGGATTGTTGT
CGAGAGCAGTGCAAGGATTGCAGTTATAGGAAGTTTAGTGGGGTGAAAAA
TGGGGTAAACCCTAATCGCGGAAAACGGTCACTCCTAGCGTGATTTAGGT
TACCCGGCCCTAGAGATGATGGCCCAAAATGGAGGTCTTGTGTT

Sequences in the Contig:

SY0AAD8YK02FM1