Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD8YH18FM1
Length(NT) : 665
Best Gene Model Blast : Link to GSTUMT00003400001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Transcription].
Kog Number: KOG3598 Score: 161 E_value: 3e-12
PFAM Definition: Gag_spuma, Spumavirus gag protein..
Pfam Number: pfam03276 Score: 122 E_value: 1e-07

Sequence:
>SY0AAD8YH18FM1
TTGGGGGAATTACACCAGATGCGGCAGATACAGCGGGCTCGGGCAGCTCA
TCCGCAGAATGTCGGGCCGAATCAACCGGCTCAGCAACCTCCACGACCTC
CTGCTCCACCGCAAACACCCATCACCCGTCCTCAGCCACCGCAGCAGCAG
CCCCAACAATCGCAGCAGCTGCATCATCAGCAGCAACAACCTGGATCGGG
AGATTCTCCCTCGGCCTTGAAAAAGACGAAGCGTGAGAGGGATCAGAGCG
AGGATGACTTGGTGGTAATAGATCGGAAGCAAGCTGTGCAGCAACCTCAG
CGACCTGGACCGGATAGGCCACAGGGACAACAACCGACCGGCCCGTCTCA
GTTCTCAAACCAGGTTCAGCAACAGGCCCAGAAGACGAATGCTCCTCAAC
AAGCCCCCATGCTTCCAGGAAATGCCGCCCAAGCCGGTCAAGCTATCTCG
GAAGCGACGGCGGCCAAGCAAGCAGTCATGGAGAAGGAGCAACAAGGGCA
GAACTTGAACCAACGAATGCAGATTAATGGGTTGATGAAATTGCTTGAGG
AGGAGAAGAACAGCCATGAGAGTCGATTGCCGCTTCAACTCGACGCTAAT
GAGCGAGGGTTTCTTCGACAACAATTGGGTGATGAGAGCACGAAGAATAT
GATTCGCCGTACAGA

Sequences in the Contig:

SY0AAD8YH18FM1