Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD8YG24FM1
Length(NT) : 533
Best Gene Model Blast : Link to GSTUMT00007118001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_08774
Accession: ref|XP_001241611.1| Score: 400 E_value: 1e-37
KEGG Definition: hypothetical protein
Accession: ang:An15g04690 Score: 398 E_value: 1e-37
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG1314 Score: 357 E_value: 4e-35
PFAM Definition: zf-DHHC, DHHC zinc finger domain. This domain is also known as NEW1. This domain is predicted to be a zinc binding domain. The function of this domain is unknown, but it has been predicted to be involved in protein-protein or protein-DNA interactions, and palmitoyltransferase activity..
Pfam Number: pfam01529 Score: 270 E_value: 5e-25
Swissprot: Q5BD15|PFA4_EMENI
Gene Ontology:
GO:0005789 = Cellular component: endoplasmic reticulum membrane

Sequence:
>SY0AAD8YG24FM1
TTGGCATCTCTGCTCTACAACCATGCTGGACCACTCCTTCTCTCGCCTCG
CAGTGGTAGGAGTAGTCCTCTTGATTGCCTTCCTCGCATACGCGTCCCAA
TACTTTCTCCTATATTCCCACCTCTCCGAGCCCGAATACGTCCTTTTCAA
CATCTGCGTAGCCTGCATCTGGATAACCTACGCCCGCAGCATCCTCACTT
CCCCAGGCAGTCCTCCTGTAACATGGACGCCCGTAGACATCGACCTCGAC
AACGCCGACGCCGAGGACGGTAGCGCCAGGGAGGAAACTCGAAGCCTGGT
ATCCCGCGGCGCGAAGTGGTGCCGAAAGTGCAATGCTTACAAGCCTCCGC
GGTGCCACCATTGCAAGACTTGCGGTGTGTGCGTGGTTCGTATGGATCAT
CATTGCCCTTGGACGAATAATTGTGTCGGCTGGAGGAATTTCCCGCACTT
TTTGAAGTTTTTGGGGTATTCTGCTTTTACTTGCTGTTGGTTGTTCTGTC
TGTTGGTTGAGAGGGGATGGGAGGTTTGGGTTC

Sequences in the Contig:

SY0AAD8YG24FM1