Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD8YF23FM1
Length(NT) : 557
Best Gene Model Blast : Link to GSTUMT00012153001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: Ankyrin repeat protein
Accession: gb|EDP48589.1| Score: 280 E_value: 1e-23
KEGG Definition: ankyrin repeat
Accession: aor:AO090113000090 Score: 242 E_value: 2e-19
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG4412 Score: 173 E_value: 1e-13
PFAM Definition: No Hit Found
Swissprot: Q6F6B3|TANC1_RAT

Sequence:
>SY0AAD8YF23FM1
TTGGGACAACCTATATGGCGAGACTCCACTCTGGTGGGCCGCTAGAAATG
GGCATGAGGGGGTGGTAAAGATGCTTTTGGACAGAGCGGATGTCAATCCC
GACCAGGCAGACACCCAATATGGCGGTACACCACTCTGGTGGGCCGCTAG
AAATGGGCATGAGGGGGTGGTAAAGATGCTTTTGCAACGAGCGGACGTTA
ATCCCAACCAGACAGACACCAAATATGGCCAGACACCACTCTGGTGGGCG
CTCTCCATAGGCCATGAGGAAGTTGCGAGGATTCTGCAGCAGCAGGGCAA
TATCAGCTCCGACACAACTGATCCTGGCGGCCAGGCATCACTCCCACCAT
CCACTCGGGATGAGGGCGAGCCCCCTGCGGAGATCCAACTCCCAACCGAT
GACCCCACCACTGACATTGCTGACCTCCCACTGGTGGACCCAGATGAGAA
GGATGGGACACCTGACATCAATCACTTTATTCCCACGTCCATAGATAACG
ACCTCTCAACCGAACCGTCCACCCCGCCTCAACACCCTTCCACCCGCCCC
CTCAAGT

Sequences in the Contig:

SY0AAD8YF23FM1