Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD8YF18FM1
Length(NT) : 607
Best Gene Model Blast : Link to GSTUMT00002622001 E-value : 2e-61
Numbers of ESTs : 1

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG2051 Score: 135 E_value: 3e-09
PFAM Definition: Nucleoplasmin, Nucleoplasmin. Nucleoplasmins are also known as chromatin decondensation proteins. They bind to core histones and transfer DNA to them in a reaction that requires ATP. This is thought to play a role in the assembly of regular nucleosomal arrays..
Pfam Number: pfam03066 Score: 119 E_value: 2e-07

Sequence:
>SY0AAD8YF18FM1
TTGGCTTCCTCGGCGGCCCGAAAGTGTCGGCCAGGTCATCAGAGTCTTCG
CCGTCTCTAGCAACCACAAGATGGCGCTTGCGCGAGGAACCGAATGACCT
CCAGGCAGGTACTTTCTTTCCATCAGCCTTGTCCACCATAAACGTCTGAA
TTTGTCTGCCTGACCTCAAGACATGAGTATGTTCAAGGGGGACGGGAGAT
TGCTTACCAGCAGGAGAGATTCGGCCCGGGAAACGAAGAGAGACAGGAGC
TTTATGGATAACGTCCGGTAATAGTACTGGGTCTGACGATGAATCGCGGA
CGCCATCTTCTACAGAATCGCGGCCCGAATCCGCTGCCCCATGAGCGCGA
CGTGTACGCCCCGTTCTTGTATTCCTGCTTTTTCCCCCACTCAGCTTCTG
CCCGCTTCTGTCCTTTGTGGGCCGTCTTGCAGCCTTGGTAGAGGATTCTG
GCTGGCCCTCGCCGTCACCGTCATCGTCATCGTCATCATCGTCATCGCCA
TGGTCATCGCCATCCGCATGGTCCTCGTCCTGGTCCTCATCCTGGTCCTC
GTCCTGGTCCGGCTCATTTTCATCGTCCGGCTCATTTTCCTCATTATCAT
CTGGGCT

Sequences in the Contig:

SY0AAD8YF18FM1