Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD8YC10FM1
Length(NT) : 595
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001537123.1| Score: 179 E_value: 8e-12
KEGG Definition: hypothetical protein
Accession: ani:AN5416.2 Score: 163 E_value: 3e-10
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAD8YC10FM1
TTGGATCTGGTGTCAGAAAGAAACAATCAACCACTCACATATATTTGTAT
TCGTAGAAGGAAGTTGGAGCCTTCAACTACATTCAATTGCTTGATGGCCT
AGAAGGATTCACGCTTGCTCTGTTCACAAGGATTCTTGGATGGTCAGCAG
ATGAAGTTCAGGTATTGCTTGCATCAGTGAGGACTGCTGTAAAATCTCGG
GCAATACATGCGCAATTTAACCTGCATGTTGTATATGCTCAGAGACCTGT
TGAGGATACAATTTGAGTTTGTTAAAGGGTAGATAAGAGTCAGGTGCAAT
TTGCAATTAATGTTTTACGGCCATCACGAATTTTAGAGGGGAAGGCGTCA
TTGGAGATTGGAATTCCCTGTCGTGAACGGTGATGAGCCCATATCTTTCT
CACAACTTTGTTTCTCAAATTCGCAAAGAAAAAGATCCTGAAGTGGCTAG
CCAAGCTAATGCAGCTGAAGCAGAGTCGTTATTACTATCAAGAGTCTTCA
TTGTAGTACATAATATTTTCAGCCATCTAGAGCTTCCTCGGATGTTTGTT
CCTATTAAGCTAGCACGCTCCTATGATCCCAACTCAAATCGCACA

Sequences in the Contig:

SY0AAD8YC10FM1