Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD8YB15FM1
Length(NT) : 503
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG4462 Score: 158 E_value: 5e-12
PFAM Definition: Extensin_2, Extensin-like region..
Pfam Number: pfam04554 Score: 151 E_value: 3e-11

Sequence:
>SY0AAD8YB15FM1
TTGGACACACATACACCCCTCTCTCTCCCTCTCTCACAACTAGACGCACT
AGAAATATTTCCTTCTGCTGCACCTTCCATTCACTACGGCGTACAAGAGA
TACCGGTAGATTTCCTTCTCTCTCCCTTTTTCCTTTTCTTTCTTTCTTTA
GCCCATCGCCCAGATTATGGCGCACACCCTCTACGAGTCGCACATCGACG
CCGCATTCGCCGATGAGGACACTTCGATAAATGGGTACGATGACGACAGT
ATGCTGGTTACCCCCCGAGGGGACGACAGTGGGAAGTTCACTGGCGCGGG
TGGTGGAGGAGATGCTGGTGTTGGTGGTGGAGGTGGTGGTGGTGGAGGGT
TGGGTTCCCTAGCGGACGAACTTGCCGGGGCCATGTACGATTCTAACGAG
GAATATGATGACGAAGAGGCCGGCGAGGGGAATGGGTATGGGGAGGGCGG
GCCTGAATGGCGGGATGGGGGTGGAGGCGATGATGGTGGGGGGGGGGTAC
TAA

Sequences in the Contig:

SY0AAD8YB15FM1