Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD8YA09FM1
Length(NT) : 613
Best Gene Model Blast : Link to GSTUMT00008654001 E-value : 1e-114
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_07661
Accession: ref|XP_001553248.1| Score: 200 E_value: 3e-14
KEGG Definition: hypothetical protein
Accession: ang:An12g05360 Score: 184 E_value: 1e-12
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAD8YA09FM1
TTGGGCCAGCGACCCAAGCAGATTCTTTCTATCGGATGCCGCAGCTTTGT
TGTCAATCTGGGTCAATTCCTTCAAATATATTCCCAACTCGTCATACGAC
CGACCGATCTTTTTCAGCGATTCCGGGCCATTTCTCAAAAGCCACTTTGG
GGAGATAACCAATGGGATAATGTTATCCAATACATGGTTCACAGCCTTCC
CATACGACATCTTGTGTCCTGGCGGGATGTTCCGACCGAAATGCTCTGCC
GTCTCACTCTCATGATCGAAGGGCAGGGCTACCCCAAAATTGCTGAGGGA
TAGCACGTTCATTGAAATTGTGCGGAGATCTCGGCCAACATTCTCGCAAG
AATTTTTGCGATTCCAGACGTTGACGGCGGCGTACGCCTGTTTGATACCT
TCATCCCATACAACCTTGTTCACAGTTTCGTTGAACGGAGGACGGGTGTA
CTTATTATGCCGGCGCCAGTCTGCCCCCCCGAGCTGAGTTATGCTTGTTA
GCCAGTGAAGCTTAGTGACAATGGAAGAGCTCCCCATACTGTCAATACGT
TATCCCCATAAAAGCGAACATATTCTAACTCCCGGATTAGTTTTCATTAT
CTCACCCCTCCCC

Sequences in the Contig:

SY0AAD8YA09FM1