Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD7YM22FM1
Length(NT) : 573
Best Gene Model Blast : Link to GSTUMT00002592001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein LELG_02172
Accession: ref|XP_001527343.1| Score: 364 E_value: 2e-33
KEGG Definition: CaO19.5392; hypothetical protein
Accession: cal:CaO19_5392 Score: 363 E_value: 2e-33
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG3098 Score: 142 E_value: 4e-10
PFAM Definition: No Hit Found

Sequence:
>SY0AAD7YM22FM1
TTGGGCGAGCAATCTATGGATGGGTTATCCTGTGTGTGGCTGTCAACTCT
ATTTGGGGTGGTGGCTTGAAGCCTTTGTTAGAGTCGTCCCGCGATAAGTA
TCCGGATAATGCCCCAGCCATCGACGTCTTTGACAAGGATTTTACCTGGT
ACCTTCTACTTTATATGGCTTACGGATTTCAAGATGCGATGTGGCAAACA
TATGCATACTGGATGATGGGAGCCCTTTCCAATGAACCCCGTAAACTCGC
ATACTTTGCGGGTTTTTACAAGGGTATTCAATCCGCAGGAGCTGCTGTTG
TCTGGCGGCTGGATGGTGTTCAGTACAGCTACGCGACCCTATTCGGATCT
TCGTGGGGACTCTGTGGAGCGGGAATGCTACTGGCAATCCCGGTCATCTG
GAGACGCATCAAGGACACCGAGCTTACGCAGGAGGATTTCATAACACCTG
CTGAGAAAGACATCGTGATGTCGGACGCGAAGCAGGTCGTGTTAGCTCAT
GAAGGTGGGGCTTGACAATTGTGCGTTTTTAGGGGCAAATTTCTTTCTAT
TTCATGAACGTATATTTTTTTAA

Sequences in the Contig:

SY0AAD7YM22FM1