Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD7YL10FM1
Length(NT) : 546
Best Gene Model Blast : Link to GSTUMT00010918001 E-value : 3e-66
Numbers of ESTs : 1

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001407409.1| Score: 129 E_value: 4e-06
KEGG Definition: predicted protein
Accession: mgr:MGG_12092 Score: 129 E_value: 2e-06
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAD7YL10FM1
TTGGCATGAACCTGCTCAATAGAAGTCTTGAAGGCGTCGTTGCTGTATCC
TCCCCCTACCCTACCCCTATCTTCAGCTTTTTTTGGGCCGTGAGTGGGCT
GGGTGAACATGAGGAGGGCACCACGAACGAGCCATACGAAATGCCTTGGC
GGTTTGTTGATTCTGCATGGCTTGTTCATTCGTTGGACCTTCTCACGGTC
TACGGCGCTCTCGTGCTCGGTGGGTCAGTAGGCTAACGTCTGTCCCGGGA
CGCATAGGTTGGCAGGGAATTTGAGAGTGTCGAAGCATTGTGGTCACAAT
TCGAGGGGGTCATGGGGAAGAACCCGGATGAGGCGAAGACTGAAGGTGTG
GGAGAGGGGGATGACACACGTATGGGTGGGTGAGGCCATGGGGGATTTAT
GAGCGGATATGTGATACAAGTAAATAAACGAATTAGGGGGGTTCTAATCT
GTTTTTATTTTCTATTTTCTATTTTTATTTTTTACCACTGCTACGGTCTG
AGAGGAAGGCGCGGATTGCCTTTGCAGATTCGTGGGCGGTTTTGAA

Sequences in the Contig:

SY0AAD7YL10FM1