Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD7YL09FM1
Length(NT) : 460
Best Gene Model Blast : Link to GSTUMT00003256001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein An08g02480
Accession: ref|XP_001392364.1| Score: 162 E_value: 4e-10
KEGG Definition: hypothetical protein
Accession: ang:An08g02480 Score: 162 E_value: 2e-10
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: A1D327|MED16_NEOFI

Sequence:
>SY0AAD7YL09FM1
TTGGCGACACAACTGCCGCAGCCTTCGCGGCCTAGAAACAACAGCAGGCA
AACACCTCTCCTCCACCCTCTCCACCGCCACGGACGAGGAAACCAAGGCC
ACCTTCCGCAGCCTAAAAGTGCCCATAGAATCTTGCGCCGTCAAGATCTC
ACAGTTCGAGCGCATAATGACAGACATCGACGGCACCATCCGCGCAGCCT
ACCACAACGTCCCCGAAGCGGAACGTGCGCAGGCCGAGAAGCTGCTCTTC
GTGAACAACGAGATACCTCCTATATTCCGCCTTGCGGTAGAGCGTCTGTT
GAATACTACGCTACCGAACCTCCGGAACGACCTGGACATTGCAAAGTTGT
TCTGGCACGACGTTACCTGGCTTGGCTTCCACGATGATGTTGCCAGCTGC
GAGTATCGCAGGAAGAATCGGATTGATGCGATTCGGAAAGTGGTGCTACC
GAAAGATGAC

Sequences in the Contig:

SY0AAD7YL09FM1