Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD7YK23FM1
Length(NT) : 582
Best Gene Model Blast : Link to GSTUMT00001818001 E-value : 1e-112
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_03547
Accession: ref|XP_001244106.1| Score: 249 E_value: 6e-20
KEGG Definition: hypothetical protein
Accession: ang:An16g03800 Score: 245 E_value: 8e-20
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAD7YK23FM1
TTGGTCCCTACCTACTCGCTCCGCACAAGGGCCAACAGCAATCACGATAA
TACCCTTTAGAACCTCCAGCAAAGATCCGGTCGACCTTGCAGGATGGGGA
AACCAAGAGTGAGTTCCCTCCCTGGACTACGGTGAAAGGGAGCTGACGGC
GGCGGCGAGGGGAAGCTAATCGTCATCATCCGACATGCTCAAAGCGAAGG
AAATAGTGTGTTCCCTTCAATAGCCCTAACTAAATTCAATATCTGACCCT
CTGCTACAAGAAAACAAAGCAATCCACCAAACCGTACCAGATCACCGCGT
GAAATTAACAAGTGAGGGAATTCGCCAGGTTAGCTCCCCACCTTACTCAA
ACCACCAGACCATCCAAGCTAATTCCCGTAGGCAGCCGAAGCCGGGGAAC
GACTTCTGAAGCTCCTCCGCCCGGAAGACACCCTGCGAATAATCACCTCC
CCGTACCTGCGTACTCGTGAGACTACCAACGGGATACTATCACAACTATC
TAGGCACCCTAGCGCAAGCAAGATTAAGGTATACGAGGAGCCACGGATAC
GCGAGCAAGATTTTGGCAATTTCCAACCCTGC

Sequences in the Contig:

SY0AAD7YK23FM1