Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD7YK14FM1
Length(NT) : 669
Best Gene Model Blast : Link to GSTUMT00006448001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_11832
Accession: ref|XP_001586803.1| Score: 186 E_value: 3e-23
KEGG Definition: hypothetical protein
Accession: mgr:MGG_03321 Score: 198 E_value: 3e-14
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG1894 Score: 131 E_value: 1e-08
PFAM Definition: No Hit Found
Swissprot: Q04418|RBA50_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0005515 = Molecular function: protein binding
GO:0006366 = Biological process: transcription from RNA polymerase II promoter

Sequence:
>SY0AAD7YK14FM1
TTGGCTCCAAATGCATCTCAAAGCACTGGGTTCCCCGAGCATAGAAATCG
GGTTCGTGGTCCATCAAAATTCAGACAAAGAATACAGGGGACTCTCCCGA
AAAACCAGATGAAAGACACCCTTACTCCAGAGCGAACGGAGAGGCAAATT
ATAAGTGATCAAAATGAGCAACTCATTGCGAACATGTCACTAGATGACAT
TGAGAAGGAGCGAAAGGAGTTGATGGAAAAATTGCCTGCTGGCCTTATTG
AGCGATTTCTAAAAAAACCCCAGATGGGTAACGGGGAAGTTCATGGCTCC
TTCAAGGACTCGAAAGTTGACGGAAACGGATTGAATTCTGGGCCGGGCTC
CAATCCAACTTCAGAAGGTCAACAAAGACCAAGTGACCGCCCAAAGCTTA
CAAAGAAAGTCACTTTCGAGAACGACCCCCCACCAGCGGCTGGATGACGA
TAATCTTCTTCCTTCAGTTAACATGCACTTCCCAAAACCCACTGCAACAG
CCGAGATTGACGAACTCGACCCCGACTCCCCTGAATTTCTCGAAAAGCTC
CATACAAAATACTTTCCCAGCCTTCCTGCCGATCCCTCAAGACTCGCCTG
GATGGCACCCATCTCGTCTGAAGAAGACAAATCATCCTACCACCCGTCCC
AACTTGACCTATCTGCGTC

Sequences in the Contig:

SY0AAD7YK14FM1