Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD7YI22FM1
Length(NT) : 524
Best Gene Model Blast : Link to GSTUMT00011995001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_03534
Accession: ref|XP_001794092.1| Score: 413 E_value: 4e-39
KEGG Definition: hypothetical protein
Accession: ncr:NCU01272.1 Score: 365 E_value: 8e-34
KOG Definition:
Classification: [General function prediction only, Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG2019 Score: 364 E_value: 6e-36
PFAM Definition: M16C_assoc, Peptidase M16C associated. This domain appears in eukaryotes as well as bacteria and tends to be found near the C-terminus of the metalloprotease M16C (pfam05193)..
Pfam Number: pfam08367 Score: 392 E_value: 3e-39
Swissprot: Q7S7C0|CYM1_NEUCR

Sequence:
>SY0AAD7YI22FM1
TTGGAGGACCTCCCGGAGGAGCTGAGAGTGTATTTGCCATTATTCACCGA
GGCAATCCTCCGACTTGGCACTGGGAAGCGTTCGATGGAGGAGCTAGAAG
ATGAGATTAAACTCAAGACGGGCGGTATAAGGGCGTCGACTCATGTTTCG
ACTAATCACTCGAATCTTGAAGTCACAGAAGAAGGGCTTGTTTTCTCAGG
ATTTGCACTGGACAACAACATACCAGACATGTTTGAGCTTTTGCGGACGG
TGCTGCTGGAGACAAACTTTGCCCAAGTGTCTAAGCTTCGAACATTGGTT
CACGGAATTGCCAGTGGTTTTGTGAATAGCCTCGCAGTGAGTGGTCATGC
GTATGCTAGGACATTCGCCGCCGCTCATCTGACACCAGGTGCTAGAGCCA
ATGAAGTGCTTGGAGGTATGACGCAGGTGAGGTTGATCAGTAATATGGCT
GCCACCGAGGTTTACAATGAAGCTCTAGCGAGATTAAAGGAGATCGCCGA
GTTCGCAGCGCGAAAAGACCATCT

Sequences in the Contig:

SY0AAD7YI22FM1