Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD7YI12FM1
Length(NT) : 623
Best Gene Model Blast : Link to GSTUMT00009949001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein An16g08860
Accession: ref|XP_001398184.1| Score: 414 E_value: 5e-39
KEGG Definition: hypothetical protein
Accession: ang:An16g08860 Score: 414 E_value: 2e-39
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG2147 Score: 379 E_value: 1e-37
PFAM Definition: Nop14, Nop14-like family. Emg1 and Nop14 are novel proteins whose interaction is required for the maturation of the 18S rRNA and for 40S ribosome production..
Pfam Number: pfam04147 Score: 337 E_value: 1e-32
Swissprot: Q6C2F4|NOP14_YARLI
Gene Ontology:
GO:0005730 = Cellular component: nucleolus
GO:0005515 = Molecular function: protein binding
GO:0030515 = Molecular function: snoRNA binding
GO:0030490 = Biological process: maturation of SSU-rRNA
GO:0042274 = Biological process: ribosomal small subunit biogenesis and assembly

Sequence:
>SY0AAD7YI12FM1
TTGGCTTTACTCTATGAACAATGCCGGAGTCCCAACTCAAACGCCTAAAG
GCATCGCTCCGAACTGCGGGCATAACCGGCCAGCAGAAATCAAAGAAAGC
AGCCAAGAAACAGAGGAAATCGACTATTAAACACGACTCTAGACTTGATC
GACATGCTACGTTACAGACAATTCGAGAGGAGTTCAATCCTTTCGAAATT
AAGACGACCCGGGAGAAACATGCGGTGATTGGGAGGGGCAAAGCTAAGGG
CGCGCAAGGGCGACCAAGTTTGAGCAAGCAGATTGGAGAGGAAAATAGAA
AACGGACATTGTTGGTCGAAATGCAGAAGAGGAATAAAGCCGGTGGGATT
TTGGATAGACGCTTCGGGGAGAACGACCCTACAATAACACCGGAAGAGAA
AATGCTCCAGCGATTCACCAAAGAAAAGCAGAAACGAGTCCGCGGCGGCG
ATATATTCAACCTTGACGATGACGACGAGCTGACTCATTTCGGCCAATCC
CTCGGCGGTCTTACAGATGATTTTGACGCTCAGAACGACTTGATGCTCTC
GGATGATGAGCCCACCCGAAAACGACCGTTAGATACGGAAGGTTTAGGGG
ATGAGGATGCCTCGCCCGGGCGC

Sequences in the Contig:

SY0AAD7YI12FM1