Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD7YC04FM1
Length(NT) : 654
Best Gene Model Blast : Link to GSTUMT00009950001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_05100
Accession: ref|XP_001593672.1| Score: 314 E_value: 3e-34
KEGG Definition: hypothetical protein ( hypothetical protein B5O22.240 [imported] - Neurospora crassa OR74A )
Accession: ncr:NCU01503.1 Score: 316 E_value: 4e-34
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG1980 Score: 187 E_value: 3e-15
PFAM Definition: No Hit Found
Swissprot: Q07381|TSR1_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0005730 = Cellular component: nucleolus
GO:0005515 = Molecular function: protein binding
GO:0043021 = Molecular function: ribonucleoprotein binding
GO:0006364 = Biological process: rRNA processing

Sequence:
>SY0AAD7YC04FM1
TTGGCACAATTGCATACAACCACCTGTTGCTGGAACGGCATCGACTCAAA
AGCCCAACTACGAAAACCGTTAAAGGGCGATTATTGAAACGGAGAGATCA
CCGTCCTAGAGAATTTTCTACTCAGCTATAAATCACAATATGAGCGCCTC
CGTTGTGCATCGTCACAGGTCCACTACGAAACAATCTCACAAATCATTCA
AGAGTCGACATGCGACAAAATCTTCTCTGAAAACTAAGAGTAGAGGTGGT
TTGTCTGTGGCCGTATAGATTACAGGTAAACCAAGCTAAATTTATGTACA
GGCAAGGTCGATGAGCCAGATACCTTCAACCGGAGAAGTCCCCACCAGCA
TATGATGTCGAAAATGGATCGCCGAAATAAAAATCGCCAAATAGCGCAAA
ACAAGCACAAGGATCTTATCCGTGAGACCAAAATATTTGATGGGCGGAAT
GGTGCTCCAAGAATTGTTGCTGTGGTGCCATTGTGTGAGGATGGGGATGC
GCAAGCTGCGATTAAGCAATTGAAGGAGGTGGAAGGTGATATTCCAGAAG
TTGGGGCGATTACGACTAGAATTGAGAGGTTCAAGCAGAAGATACAATGG
ATTGTGGTGAAGCGGGATTTGTTATCCGTACTAGACGCTTGTAAGGTGGC
CGAC

Sequences in the Contig:

SY0AAD7YC04FM1