Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD7YB19FM1
Length(NT) : 328
Best Gene Model Blast : Link to GSTUMT00002438001 E-value : 4e-52
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein NCU01177
Accession: ref|XP_961543.1| Score: 168 E_value: 8e-11
KEGG Definition: hypothetical protein
Accession: ncr:NCU01177.1 Score: 168 E_value: 4e-11
KOG Definition: No Hit Found
PFAM Definition: RmlD_sub_bind, RmlD substrate binding domain. L-rhanmose is a saccharide required for the virulence of some bacteria. Its precursor, dTDP-L-rhanmose, is synthesised by four different enzymes the final one of which is RmlD. The RmlD substrate binding domain is responsible for binding a sugar nucleotide..
Pfam Number: pfam04321 Score: 123 E_value: 2e-08

Sequence:
>SY0AAD7YB19FM1
TTGGGGAGGAGGTGAAGTATACTTCTCTCGGGCCAGTTATCTCACAAGGA
GGCCTAATCTAACGCGATGCCTTACGGATAGGCCCAAGGTGGTGGTTCAC
TAACGCTTCCCGGACAAGTGCGACGCAGACCCCGAGGGAGTCAAACGCCT
GAACGTAATTGAGCTCTCAGCCAACCCATATTTGTTCAAAGCAGCTCATT
TATACGCCTATGCATGAGAAATCCAGGTTCAAGCATCAAACAGCCTCGCC
CAGGAATGTGCAAATCGTGACATAATCCTAATCTACATATCCACCGACTA
CGTTTTCGACGGGAAACCCGGTGCAGCT

Sequences in the Contig:

SY0AAD7YB19FM1