Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD7YA17FM1
Length(NT) : 205
Best Gene Model Blast : Link to GSTUMT00007432001 E-value : 7e-96
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_11926
Accession: ref|XP_001586897.1| Score: 210 E_value: 1e-15
KEGG Definition: 20S cyclosome subunit (APC1/BimE), putative; K03348 anaphase-promoting complex component APC1
Accession: afm:AFUA_3G05950 Score: 175 E_value: 6e-12
KOG Definition:
Classification: [Cell cycle control, cell division, chromosome partitioning, Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG1858 Score: 151 E_value: 1e-11
PFAM Definition: No Hit Found
Swissprot: P24686|BIME_EMENI

Sequence:
>SY0AAD7YA17FM1
TTGGCGCCTCCCCACACCACTGGACTGTGGTTACTGAGGTAATTTGGGTG
AGTTCGGGGAGGAGGCAGGGGGCATTCCTGTGCAGTTCTTCACCTGTGCG
GAGGGTTACGGTTATAGGAATTGCACAGGGTCGGTGAGTCTCCACGTCCC
GGGCTACGAGACAGCGGGCTTCGGCTGCAAGGACCCAAAAGTGGCGGAAG
GATTG

Sequences in the Contig:

SY0AAD7YA17FM1