Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD6YP18FM1
Length(NT) : 538
Best Gene Model Blast : Link to GSTUMT00000115001 E-value : 1e-147
Numbers of ESTs : 1

Blast Results:

Nr Definition: Ankyrin repeat protein
Accession: gb|EDP48589.1| Score: 357 E_value: 1e-32
KEGG Definition: ankyrin repeat
Accession: aor:AO090010000141 Score: 322 E_value: 8e-29
KOG Definition:
Classification: [Cell wall/membrane/envelope biogenesis].
Kog Number: KOG4177 Score: 220 E_value: 4e-19
PFAM Definition: No Hit Found
Swissprot: P16157|ANK1_HUMAN
Gene Ontology:
GO:0016323 = Cellular component: basolateral plasma membrane
GO:0005856 = Cellular component: cytoskeleton
GO:0008093 = Molecular function: cytoskeletal adaptor activity
GO:0019899 = Molecular function: enzyme binding
GO:0030507 = Molecular function: spectrin binding
GO:0005200 = Molecular function: structural constituent of cytoskeleton
GO:0007010 = Biological process: cytoskeleton organization and biogenesis
GO:0006887 = Biological process: exocytosis
GO:0045199 = Biological process: maintenance of epithelial cell polarity

Sequence:
>SY0AAD6YP18FM1
TTGGGGGATTCACAGGACTTCACGCTGCAGCATTCCTGGGGCTTGTGGAT
ATAACCATTGCTTTATTGAAAATCAAGGAATGGGACCCCAATGCAAGGAA
CCCCGAAGGTGATACCGCCCTTATATTGGCTGCTATGAACGGGCATGAAG
GAGTTGTGAGGGTTCTATTGGAAAGGATTGACACCAATCCGGAAAAGTCA
GACTATTGGGGCCGAAGGCCTCTCTCCCGCGCCGCGAGCAACGGGCATGA
AGGAGTTGTGAAGCTGCTGTTGGAGCGGACTGATGTCAATCCAGAAATGG
CAGATTGTTGGGGCCGAAGCCCACTTTCGCTGGCTGCCGAGAATGGGCAT
GAAAGGGTTGTTAAGATCCTATTGGAACAGGAGGGCGTCGGCCCGAATAC
AGTAGACATCAAATACGGCCAAACGCCCCTCTCATGGGCTGCCGAGAAGG
GGCATGAGGCAGTTGTGGAGATGCTATTGAAGCGGGACGATGTCAATCCC
GAACTCGCAGATAAGTATGGTAGAACATCACTTTCGTG

Sequences in the Contig:

SY0AAD6YP18FM1