Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD6YO03FM1
Length(NT) : 577
Best Gene Model Blast : Link to GSTUMT00005852001 E-value : 1e-151
Numbers of ESTs : 1

Blast Results:

Nr Definition: putative MAP kinase
Accession: gb|AAY82585.1| Score: 581 E_value: 2e-58
KEGG Definition: MAP kinase SakA [EC:2.7.11.24]; K04441 p38 MAP kinase
Accession: afm:AFUA_1G12940 Score: 579 E_value: 2e-58
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG0660 Score: 489 E_value: 2e-50
PFAM Definition: Pkinase, Protein kinase domain..
Pfam Number: pfam00069 Score: 375 E_value: 4e-37
Swissprot: Q2WGK3|HOG1_TRIHA

Sequence:
>SY0AAD6YO03FM1
TTGGCTTACCGTGAGCTGAAACTGCTCAAGCACTTGCGGCATGAGAATGT
CATTAGTCTTAGCGATATCTTCATATCTCCTCTGGAGGACATGTACGCCG
ATAGCACTCACTATATACTGTAGCTGCGTGCTGTATTCTAATATTTGGAA
TAGTTACTTCGTCACTGAGCTTCTTGGTACTGATCTGCACCGATTATTAA
CCTCTCGGCCGTTGGAAAAGCAGTTCATCCAGTACTTTCTATACCAGATT
CTGGTAGGCTACCTAAAAGGCCGACTAAATGGAAGGTGTGCATGCTAACG
TTGTTACAGCGCGGACTGAAATACGTTCATTCCGCTGGCGTCGTTCATCG
TGACCTGAAACCTAGCAACATTTTAGTCAACGAGAATTGTGATCTCAAAA
TCTGCGATTTCGGTCTTGCTCGGATTCAGGATCCCCAGATGACCGGCTAT
GTCTCTACAAGGTACTACCGCGCACCGGAGATTATGCTCACATGGCAAAA
GTACGATGTCGAGGTGGATATCTGGAGTGCGGGATGTATATTTGCGGAGA
TGCTCGAAGGAAAGCCGCTGTTCCCAG

Sequences in the Contig:

SY0AAD6YO03FM1