Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD6YN24FM1
Length(NT) : 628
Best Gene Model Blast : Link to GSTUMT00000179001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: Ankyrin repeat protein
Accession: gb|EDP48589.1| Score: 473 E_value: 7e-46
KEGG Definition: hypothetical protein
Accession: ang:An02g10560 Score: 423 E_value: 2e-40
KOG Definition:
Classification: [Cell wall/membrane/envelope biogenesis].
Kog Number: KOG4177 Score: 284 E_value: 2e-26
PFAM Definition: No Hit Found
Swissprot: Q71S21|INVSB_XENLA

Sequence:
>SY0AAD6YN24FM1
TTGGGCCTAACACCACTCTGGTTGGCGGCTAGGGCTGGGCGTGAGGGAGT
AGTAAAACTGTTATTGGAACGGAGCGATCTCAACCCCAACTCACCTGATA
GCGGAGGCCTAACACCGCTCTGGTTGGTGGCTAGGATGGGGTACGAAGGT
ATTGTGAAGCTGCTTCTGGGACATGACGATGTCAACCCAAATGTACTTGG
TAACGAAGGCCTAACACTACTCTCGTGGGCCTCTAGATTGGGGCGTGAGG
CGGTAGTGCAGCTACTCCTAGAACGAAGCAACGTCAAACCCGACTTGCCG
GATAACAGAGGCCGGACCCCACTCTCGTGGGCGTCCGAAAAAGGAAATGA
GGGTATCGTTAAGTTGCTTCTAAGACGGGGTGACGTTCAGCCCGACCTAC
CTGACAAAACAGGCCGAACCCCGCTCTCTTGGGCCGCGGACAAAGGGAAC
GAGAGCATAGCAAAGCTCCTTCTGGAGCGAGATGATGTCAAGCCCGACAC
ACCCGATAGCAAGGGTCGAACACCAATCGCGTGGGCAGTCCACAGCGGAC
AAGAGGGGGCGGTGAAGCTCCTCTTGGAGCGCAGCGATGTCAACCCCAAC
TTCCATGACAGCCATCGCCGGACACCCC

Sequences in the Contig:

SY0AAD6YN24FM1